DNA sequence/string format
The DNA sequence can be provided as pasted text, file upload or with genomic coordinates
Sequence should be on a single line without carriage returns.
Sequence can contain A,C,G,T,a,c,g,t (both cases) N,n,- (unknown or gaps). But N,n,- characters will be ignored and NOT MATCHED to k-mers.
Example:
....match!.............no match.
--GGGAATTCCC--------------------
CCGGGAATTCCCAGATCG-----NNAATTCCC
DNA upload file format
File should contain a SINGLE DNA entry, only first will be used if multiple exist.
Sequence can be in FASTA format or just DNA sequence alone (see below).
Sequence should be on a single line without carriage returns.
Sequence can contain A,C,G,T,a,c,g,t (both cases) N,n,- (unknown or gaps). But N,n,- characters will be ignored and NOT MATCHED to k-mers.
FASTA format (2 lines in the file)
>DNA sequence name
AGCTGATGACGTGCGTGACGTGCAGTTGGACGTGACGTTTAGACGTGACGTGC
DNA sequence alone (1 line in the file)
ACGTACAGTCGTCGGAGAAGCGACGTCCGGTCGCGATACGAGAATGCAC